RT-LAMP

protocol with commercial reagents

Back To Homepage

RT-LAMP with commercially bought reagents is the easiest and fastest way to get started with SARS-CoV-2 detection with reverse transcription loop mediated isothermal amplification. This page has the protocol, material list and a benchmarking assay you can use to validate your LAMP reactions are effective. See the limit of detection assay for our data on the sensitivity and specifity of this method. 

Some things to keep in mind before getting started:

Materials

LAMP primer mix 10X

LAMP requires 6 primers for optimal functioning. That is 6 short DNA oligonucleotides to synthesise or order, the names are F3, B3, LF, LB, FIP and BIP. For the ease of use, one can mix those in a pre-determined ratio to make a 10X primer mix to use with LAMP. You can make this mix with As1 primers against SARS-CoV-2 genome or against human ACTB transcript. Aliquot and label the finished primer mix with the name, date and name of the person who prepared it. We encourage to test every primer mix you receive for activity against the target template, especially when ordering from vendors you don’t have prior experience with. 

Materials

SARS-COV-2 PRIMER SEQUENCES – As1 primers: 

As1_F3 CGGTGGACAAATTGTCAC 
As1_B3 CTTCTCTGGATTTAACACACTT 
As1_LF TTACAAGCTTAAAGAATGTCTGAACACT 
As1_LB TTGAATTTAGGTGAAACATTTGTCACG 
As1_FIP TCAGCACACAAAGCCAAAAATTTATCTGTGCAAAGGAAATTAAGGAG 
As1_BIP TATTGGTGGAGCTAAACTTAAAGCCCTGTACAATCCCTTTGAGTG

POSITIVE CONTROL PRIMER SEQUENCES – ACTB primers: 

ACTB-F3 AGTACCCCATCGAGCACG
ACTB-B3 AGCCTGGATAGCAACGTACA
ACTB-FIP GAGCCACACGCAGCTCATTGTATCACCAACTGGGACGACA
ACTB-BIP CTGAACCCCAAGGCCAACCGGCTGGGGTGTTGAAGGTC
ACTB-LoopF TGTGGTGCCAGATTTTCTCCA
ACTB-LoopB CGAGAAGATGACCCAGATCATGT

procedure

  1. Prepare your ordered oligonucleotides. If they are not resuspended, resuspend them in nuclease-free water for 100 μM stock concentration.
  2. In a clean and template-free workspace, such as in a PCR hood, mix the oligonucleotides in the order outlined by the table below. Make sure to add the components from largest volume to the smallest volume.
    Oligo nameAdd for 100 μl of mix
    F32 μl
    B32 μl
    LF4 μl
    LB4 μl
    FIP16 μl
    BIP16 μl
    nuclease-free water56 μl
  3. Mix the finished primer mix by thoroughly pipetting up and down or by vortexing and birefly spinning down in a microfuge.
  4. Distribute he finished primer mix into Eppendorf tubes into conveniently sized aliquots, label the tubes and store at -20 ºC.

HNB solution preparation

In RT-LAMP assays, we use hydroxynaphtol blue as the dye that lends the reaction its easy and reliable color readout. HNB is dye commonly used in metallometric titrations for water purity assessment, as it changes color from blue to pink in the presence of the magnesium cations. Using 3 mM stock solution of HNB is recommended for it’s stability and ease of pipetting even for a small number of reactions. 

procedure

  1. Weigh out 0.186 g of hydroxynaphtol blue powder on analytical scales.
  2. Dissolve the powder in 100 mililitres of nuclease free water. Make sure that every bit of the powder is dissolved in the solution to get a precise 3 mM concentration of the dye.
  3. Filter the solution through a 0.22 µm sterile filter to make a sterile solution.
  4. Store the 100 ml of 3 mM solution in the fridge at 4 ºC.

LAMP reagents

Commercial RT-LAMP assays are powered by enyzmes that are produces by specialized companies. We found the LAMP kits from NEB to be very powerful in terms of performance and sensitivity, when used with our protocol. Therefore, we recommend purchasing the following reagents to anyone trying to get LAMP working in their settings as soon as possible.

Materials

  • QuickExtract DNA solution 50ml (Lucigen QE09050), store at -20°C
  • WarmStart LAMP Kit (DNA & RNA) (NEB E1700L), store at -20°C
  • Antarctic Thermolabile UDG (NEB M0372L), store at -20°C
  • dUTP solution (NEB N0459S), store at -20°C
  • Nuclease free water (not DEPC-treated) 100ml, (Thermofisher AM9938)

Protocol

SAMPLE INACTIVATION AND LYSIS

  1. Thaw an aliquot of QuickExtract DNA solution on ice and vortex before use. (50µl per sample).
  2. On ice, mix 50µl of original sample material (nasopharyngal swab, gargle or saliva) with 50 µl of QuickExtract solution in PCR strips or in a 96-well plate; seal the plate (or close the PCR strips with the lids).
  3. Heat-inactivate QuickExtract:Sample mix at 95°C for 5 minutes, then cool on ice or store at -20°C
    [PAUSE] Sample can be stored at -20°C at this point for up to four weeks, potentially longer. Inactivated can now be handled in BSL-1 settings.

 

rt-lamp reaction

Calculate your reagent consumption according to this table

ReagentPer 10 ul reaction (μl)Final concentration
WarmStart LAMP Kit (2x)51X
Primer mix (10x)11X
HNB Dye solution (3 mM)0.4120 μM
dUTP (100 mM)0.070.7 mM
Magnesium sulfate (100 mM)0.070.7 mM
50x NEB LAMP Dye (optional)0.21X
Thermolabile UDG (optional)0.20.02 U/μl
Nuclease free waterto a total of 8 
  1. Prepare the RT-LAMP reaction mix by mixing the following reagents in the given order (top to bottom) and quickly vortex and spin down in a microfuge.
  2. Dispense the reaction mix into PCR strips or 96-well plate on ice, 8 µl per well (sample).
  3. On ice, Add 2 µl of heat-inactivated QuickExtract lysate to RT-LAMP reaction and mix carefully by pipetting the reaction up and down. Seal PCR strips by capping them, and seal 96-well plates by applying a plastic transparent plate seal.
    [CRITICAL] This step should be done in a separate work area where no reagents are handled.
    [CRITICAL] If performing colorimetric detection, take an image of the PCR strips or 96-well plate with the mastermix and samples.
  4. Transfer the reaction to a suitable stable heat-source such as a heat block or a thermocycler and run reactions at 63°C for 35 minutes.
    [OPTIONAL] For real-time fluorescence data aquisition in qPCR thermocycler, we typically perform 35 cycles at 63°C with 1-minute cycle length and reading at the end of each cycle. NEB fluorescent Dye require data aquisitons using a standard FAM or SYBR filter (494nm/518nm absorption/emission).
  5. After 35 minutes run-time, remove reactions and allow to cool briefly at room temperature. Then proceed to inspect reactions visually.Negative reactions are purple while positive reactions are sky-blue.
    [CRITICAL]
    If performing colorimetric detection, take a second image of the PCR strips or 96-well plate under the same conditions as you took the first one after the reaction.
  6. Discard the reactions immediately after noting down the results.
    [CRITICAL] DO NOT OPEN THE REACTION TUBES!
RT-LAMP color readout

Visual colorimetric

Hydroxynaphtol blue (HNB) is used in RT-LAMP reactions that do not include any purification step. The dye changes color from purple to sky blue upon presence of target sequence and amplification. This can be visualised by the naked eye, and reactions can be scored directly after taking them out of the heating device.

RT-LAMP app enhanced color readout

App-assisted colorimetric

For people who find the color change of HNB difficult to see by the naked eye, we recommend the use of a simple web app. Developed by Andrew Straw to increase the color difference between positives and negatives and make the readout much simpler. Try it out on colorimetry.net

RT-LAMP fluorimetric detection

Fluorimetric

Amplification of DNA in RT-LAMP reactions can also be read out through the use of fluorescent intercalating dyes. These dyes, such as Syto9 or the NEB LAMP dye, enable the user to either monitor the progress of the reaction in real time through the use of a qPCR machine, or end-point detection with a plate reader or a similar fluorescence detection device.

See our other protocols