bead-LAMP

protocol with commercial reagents

Back To Homepage

Bead-LAMP with commercial reagents is the most sensitive way to detect SARS-CoV-2 with reverse transcription loop mediated isothermal amplification. With fast sample inactivation and a simple bead enrichment step this method gives results in sensitivity compared to those achieved by golden standard qPCR. This page has the protocol, material list and a benchmarking assay you can use to validate your LAMP reactions are effective. See the limit of detection assay for our data on the sensitivity and specifity of this method. 

Some things to keep in mind before getting started:

Materials

LAMP primer mix 10X

LAMP requires 6 primers for optimal functioning. That is 6 short DNA oligonucleotides to synthesise or order, the names are F3, B3, LF, LB, FIP and BIP. For the ease of use, one can mix those in a pre-determined ratio to make a 10X primer mix to use with LAMP. You can make this mix with As1 primers against SARS-CoV-2 genome or against human ACTB transcript. Aliquot and label the finished primer mix with the name, date and name of the person who prepared it. We encourage to test every primer mix you receive for activity against the target template, especially when ordering from vendors you don’t have prior experience with. 

Materials

SARS-COV-2 PRIMER SEQUENCES – As1 primers: 

As1_F3 CGGTGGACAAATTGTCAC 
As1_B3 CTTCTCTGGATTTAACACACTT 
As1_LF TTACAAGCTTAAAGAATGTCTGAACACT 
As1_LB TTGAATTTAGGTGAAACATTTGTCACG 
As1_FIP TCAGCACACAAAGCCAAAAATTTATCTGTGCAAAGGAAATTAAGGAG 
As1_BIP TATTGGTGGAGCTAAACTTAAAGCCCTGTACAATCCCTTTGAGTG

POSITIVE CONTROL PRIMER SEQUENCES – ACTB primers: 

ACTB-F3 AGTACCCCATCGAGCACG
ACTB-B3 AGCCTGGATAGCAACGTACA
ACTB-FIP GAGCCACACGCAGCTCATTGTATCACCAACTGGGACGACA
ACTB-BIP CTGAACCCCAAGGCCAACCGGCTGGGGTGTTGAAGGTC
ACTB-LoopF TGTGGTGCCAGATTTTCTCCA
ACTB-LoopB CGAGAAGATGACCCAGATCATGT

procedure

  1. Prepare your ordered oligonucleotides. If they are not resuspended, resuspend them in nuclease-free water for 100 μM stock concentration.
  2. In a clean and template-free workspace, such as in a PCR hood, mix the oligonucleotides in the order outlined by the table below. Make sure to add the components from largest volume to the smallest volume.
    Oligo nameAdd for 100 μl of mix
    F32 μl
    B32 μl
    LF4 μl
    LB4 μl
    FIP16 μl
    BIP16 μl
    nuclease-free water56 μl
  3. Mix the finished primer mix by thoroughly pipetting up and down or by vortexing and birefly spinning down in a microfuge.
  4. Distribute he finished primer mix into Eppendorf tubes into conveniently sized aliquots, label the tubes and store at -20 ºC.

Ampure beads and bead dilution

 

This protocol explains in detail how to make a diluted Ampure bead solution from commercial RNA magnetic beads and pre-defined bead dilution buffer. The bead dilution is used for bead-LAMP.

Materials

  • NaCl (5 M), RNase-free, Catalog number: AM9759 (Thermofisher)
  • Polyethylene glycol solution 40 % (w/w) in H2O, average mol wt 8,000, Catalog number: P1458-50ML (MERCK/Sigma) 
  • UltraPure™ 1M Tris-HCI, pH 8.0, Catalog number: 15568025 (Thermofisher) 
  • Tween™ 20 Surfact-Amps™ Detergent Solution 10%, Catalog number: 85114
  • RNAClean XP, 40 mL, Catalog number: A63987 (Beckman Coulter) 

protocol

  1. Remove 40% Polyethylene glycol solution (PEG) from the fridge and let equilibrate to room temperature for about 30 minutes prior to using.
  2. Mix the following components in a 50 ml falcon tube and store the resulting bead dilution buffer at 2 to 8 °C.
    Reagent Amount to add (ml) Final concentration
    40% PEG 20 20 %
    5M NaCl 19.4 2.5 M
    1M Tris-HCl pH 8 0.4 10 mM
    Tween™ 20 Surfact-Amps Detergent Solution 0.2 0.05
    Final Volume 40
  3. Remove Ampure Dilution Buffer and Ampure RNAClean XP beads from the fridge and let equilibrate to room temperature for about 30 minutes prior to using it. [CRITICAL] It is important to let the bead dilution buffer and the beads equilibrate before use. Plan your time accordingly.
  4. Mix the following components in a 5 ml Eppendorf tube to obtain a 5x dilution of Ampure beads.
    Reagent Volume (ml)
    Ampure Dilution Buffer (see above) 4
    Ampure RNAClean XP beads 1
    Final Volume 5

LAMP reagents

Commercial RT-LAMP assays are powered by enyzmes that are produces by specialized companies. We found the LAMP kits from NEB to be very powerful in terms of performance and sensitivity, when used with our protocol. Therefore, we recommend purchasing the following reagents to anyone trying to get LAMP working in their settings as soon as possible.

Materials

  • QuickExtract DNA solution 50ml (Lucigen QE09050), store at -20°C
  • WarmStart® Colorimetric LAMP 2X Master Mix with UDG (NEB M1804L), store at -20°C
  • SYTO™ 9 Green Fluorescent Nucleic Acid Stain, 5mM (2500X concentration), (Thermofisher S34854), store at -20°C under light protected conditions (only needed if performing fluorescence detection
  • Ethanol, absolute (Sigma-Aldrich 51976)
  • Nuclease free water (not DEPC-treated) 100ml, (Thermofisher AM9938)
  • Guanidine hydrochloride solution, 8M (Sigma, G7294-100ML) (only needed if performing double-amplicon reactions with As1 and E1)

Protocol

SAMPLE INACTIVATION AND LYSIS (BSL2 WORKSPACE)

  1. Thaw an aliquot of QuickExtract DNA solution on ice and vortex before use (calculate for 50µl QuickExtract consumption per sample).
  2. On ice, mix 50µl of original sample material (nasopharyngal swab, gargle or saliva) with 50µl of QuickExtract solution in PCR strips or in a 96-well plate; seal the plate (or close the PCR strips with the lids).
  3. Heat-inactivate QuickExtract:Sample mix at 95°C for 5 minutes, then cool on ice or store at -20°C
    [PAUSE] Sample can be stored at -20°C at this point for up to four weeks, potentially longer. Inactivated can now be handled in BSL-1 settings.

bead-LAMP mastermix preparation (BSL-1 workspace)

Calculate your reagent consumption according to this table.

ReagentPer 20 ul reaction (μl)Final concentration
Colorimetric LAMP Kit with UTP/UDG (2x)101X
As1 Primer mix (10X)21X
E1 Primer mix (10X)21X
GuHCL (8M)0.140 mM
NEB LAMP dye 50X (optional)0.41X
Nuclease free waterto a total of 20 
  1. Prepare the beadLAMP reaction mix by mixing the reagents in the given order (top to bottom) and quickly vortex and spin down in a microfuge.
    [CRITICAL] If multiple reactions are performed, prepare a Mastermix for all reactions including a 10% excess. For example, when intending to run 10 reactions, prepare a Mastermix for 11 total reactions. This minimises pipetting errors and ensures enough reagent mixture to be distributed over individual PCR tubes or PCR wells.
    [OPTIONAL] If performing only colorimetric based detection, the fluorescent dye can be replaced with the same volume of nuclease-free water. Syto-9 can be added to record real-time fluorescent kinetic profiles and end-point fluorescence. This is especially useful when setting up the techique and optimising reaction condtions such as primers and sample types. It’s also useful for troubleshooting.

bead purification (BSL-1 workspace)

  1. To 100 μl of inactivated QuickExtract Lysate in PCR tubes, add 60µl of diuted AmpureXP RNA beads (0.6x of lysate volume), mix and incubate for 5 minutes at room temperature.
    [CRITICAL] If real-time fluorescent signal will me measured, transfer lysate to a PCR plate or PCR tubes suitable for real-time measurement. All downstream enrichment and detection steps are performed on this plate/tube.
    [CRITICAL]
     For volumes smaller than 100µl, it is important to bring the volume up to 100µl with HBSS before addition of 60µl diluted beads. We have successfully used initial lysate volumes of 40-100µl.
  2. After 5 minutes, place mixtures containing samples and beads onto a magnetic rack for 5 minutes to allow for complete seperation of beads from the solution.
    [CRITICAL]
     It is important to wait for the complete seperation to avoid loss of beads. This is usually complete after 5 minutes and should be visible by accumlation of beads at the magnet-tube interphase.
  3. Without disturbing the beads, carefully remove the solution while keeping the tubes on the magnetic rack. 
    [CRITICAL] It’s important not to disturb the beads as the nucleic acid material is bound to it and would be lost. 
  4. While keeping the tubes on the magnetic stand, add 200µl of 85% EtOH solution to the beads and wait for 30 seconds, then remove the wash solution. 
    [CRITICAL] It’s important not to disturb the beads and to important to remove any residual Ethanol since this can lead to a color-change of the Phenol dye from pink to yellow (without the reaction taking place).
  5. Remove tubes from the magnetic rack and allow the beads to air-dry for 3-5 minutes.
    [CRITICAL] Do not exceed 5 minutes to prevent full drying of the beads. Proceed to adding the master mix as soon as this time elapses and make sure there is no leftover ethanol in the reaction wells.

bead-lamp reaction (BSL-1 workspace)

  1. To each well/tube containing beads, add 20µl of LAMP reaction mixture and mix by pipetting to bring the beads into solution. Seal PCR strips by capping them, and seal 96-well plates by applying a plastic transparent plate seal.
    [OPTIONAL] Alternatively, instead of mixing the beads with the reaction mix by pipetting, swiftly pipette the reaction mix onto the wells of the strip/plate, quickly but firmly cap/seal the strip/plate and carefully vortex to bring the beads into the reaction mix solution. This is especially useful when performing a lot of reactions, where individual mixing by pipetting would lead to long time delays and overdrying of the beads.
    [CRITICAL] Ensure that the beads went into solution. The mix should appear brownish with no transparent phase.
    [CRITICAL] If real-time fluorescence is recorded, transfer reaction to a suitable detection vessel (qPCR plate).
    [CRITICAL] If performing colorimetric detection, take an image of the PCR strips or 96-well plate with the mastermix and samples.
  2. Transfer the reaction to a suitable stable heat-source such as a thermocycler or heat-block and run reactions at 63°C for 25 minutes.
    [OPTIONAL] For real-time fluorescence data aquisition of beadLAMP in a qPCR thermocycler, we typically perform 25 cycles at 63°C with 1-minute cycle length and reading at the end of each cycle. SYTO-9 or NEB fluorescent Dye require data aquisitons using a standard FAM or SYBR filter (494nm/518nm absorption/emission).
  3. After 30 minutes run-time, remove reactions and allow to cool briefly at room temperature. Then proceed to inspect reactions visually. Negative reactions are pink while positive reactions are yellow.
    [CRITICAL] If performing colorimetric detection, take a second image of the PCR strips or 96-well plate under the same conditions as you took the first one after the reaction.

  4. [CRITICAL] Discard reactions. DO NOT open and DO NOT run on a gel.

See our other protocols