bead-LAMP

protocol with commercial reagents

Back To Homepage

Bead-LAMP with commercial reagents is the most sensitive way to detect SARS-CoV-2 with reverse transcription loop mediated isothermal amplification. With fast sample inactivation and a simple bead enrichment step this method gives results in sensitivity compared to those achieved by gold standard qPCR. This page has the protocol, material list and a benchmarking assay you can use to confirm that your LAMP reactions are effective. See the limit of detection assay for our data on the sensitivity and specificity of this method. 

Some things to keep in mind before getting started:

  • SARS-CoV-2 is a highly contagious virus and requires personal protection with appropriate safety standards. Please follow Biosafety level guidelines outlined by the CDC or your local authorities.
  • Separate working areas for sample preparation, reaction set-up and analysis are highly recommended. Clean work surfaces and pipettes with 5-10% bleach solution.
  • Do not open RT-LAMP reactions in order to prevent carry-over cross contamination leading to false positives. The non-colorimetric master mix from NEB (E1700L) does not contain dUTP/thermolabile UDG to prevent cross-contamination; we recommend to add these two components to the reaction mix to lower the risk of cross-reaction contamination.
  • 96-well plates must be properly sealed. This is absolutely crucial to prevent cross-well contamination. Proper plate seals (e.g. tight sealing plastic covers or aluminium seals), a proper plate-roller (e.g. BioRad) or even better a PCR plate sealer (e.g. BioRad PX1 PCR plate sealer) can help prevent cross-well contamination.
  • Store reaction components at the appropriate temperatures outline by the manufacturer. When thawing the NEB WarmStart LAMP kit, we advise thawing at room temperature for 10 minutes with vortex mixing for 5 seconds every 5 minutes. This ensures that any Magnesium sulfate precipitate goes into solution, which is essential for proper HNB colorimetric LAMP detection and proper performance. Check Mastermix after thawing to ensure no precipitate is visible.
  • Colorimetric and fluorescent detection can be performed in the same reaction by simple addition of both dyes (the colorimetric kit from NEB already contains Phenol Red for colorimetric readout). We found that 2 µM SYTO-9 fluorescent dye to be comparable to the commercial fluorescent dye sold with NEB's WarmStart LAMP Kit. Do not use SYBR I or Eva Green as those were shown to inhibit LAMP reactions.
  • When working with crude samples lysed in QuickExtract, keep samples on ice whenever possible. While we have observed complete inactivation of nucleases after 5 minutes at 95°C, we found considerable RNase activity in biological sample types such as saliva and gargle. Due to the FBS content in Universal Transport Media (UTM), nasopharyngeal swabs in this medium may also contain RNases.
  • RT-LAMP uses six primers, two inner loop primers (FIP, BIP), loop primers (LF, LB) and outer bumping primers (F3, B3). A reaction contains all six primers if a single amplicon is tested.
  • A positive control amplicon detecting the human ACTB gene can be used to confirm the presence of human nucleic acid sample material in the sample, and the absence of general reaction-inhibiting substances in the sample.
  • We recommend As1 (ORF1ab) as the 'safest amplicon' particularly for hospital settings since it does not overlap a CDC amplicon used in the Roche Cobas assays, it has performed extremely well in our tests regarding false-positives (no false positives) BUT: it is not the most sensitive primer choice we have for LAMP. The most sensitive option for beadLAMP with the colorimetric (Phenol Red) kit and Guanidinium-HCl is the double-combination of As1 and E1 primers. Disadvantage: The E1 amplicon overlaps the RT-qPCR Cobas E gene assay, thus there is a risk of cross-contamination.
  • A crucial component of every experiment and testing procedure is the selection of proper controls. For verifying that your reaction mastermix works in the given conditions for the detection of SARS-CoV-2 genome, we recommend the use of inactivated qPCR positive patient sample, synthetic SARS-CoV-2 RNA or plasmid DNA containing the Orf1ab region. Positive controls should have a concentration exceeding 100 copies/µl. Verified qPCR negative sample is a proper choice for a negative control.

Materials

LAMP primer mix 10X

LAMP requires six primers for optimal functioning. That is six short DNA oligonucleotides to synthesise or order, the names are F3, B3, LF, LB, FIP and BIP. For the ease of use, one can mix those in a pre-determined ratio to make a 10X primer mix to use with LAMP. You can make this mix with As1 primers against SARS-CoV-2 genome or against human ACTB transcript. Aliquot and label the finished primer mix with the name, date and name of the person who prepared it. We encourage to test every primer mix you receive for activity against the target template, especially when ordering from vendors you don’t have prior experience with. 

  • Store primer mixes at -20 ºC.
  • Order oligonucleotides from reputable companies specialising in DNA oligonucleotide synthesis.
  • When ordering oligos, choose "standard desalting" as the purity. We recommend ordering primers resuspended in 100 μM concentration. You can order yours lyophilised and then resuspend them in nuclease-free water according to the supplier's instructions.
  • This procedure is applicable for every LAMP primer set we recommend here.

Materials

SARS-COV-2 PRIMER SEQUENCES – As1 primers: 

As1_F3 CGGTGGACAAATTGTCAC 
As1_B3 CTTCTCTGGATTTAACACACTT 
As1_LF TTACAAGCTTAAAGAATGTCTGAACACT 
As1_LB TTGAATTTAGGTGAAACATTTGTCACG 
As1_FIP TCAGCACACAAAGCCAAAAATTTATCTGTGCAAAGGAAATTAAGGAG 
As1_BIP TATTGGTGGAGCTAAACTTAAAGCCCTGTACAATCCCTTTGAGTG

POSITIVE CONTROL PRIMER SEQUENCES – ACTB primers: 

ACTB-F3 AGTACCCCATCGAGCACG
ACTB-B3 AGCCTGGATAGCAACGTACA
ACTB-FIP GAGCCACACGCAGCTCATTGTATCACCAACTGGGACGACA
ACTB-BIP CTGAACCCCAAGGCCAACCGGCTGGGGTGTTGAAGGTC
ACTB-LoopF TGTGGTGCCAGATTTTCTCCA
ACTB-LoopB CGAGAAGATGACCCAGATCATGT

procedure

  1. Prepare your ordered oligonucleotides. If they are not resuspended, resuspend them in nuclease-free water for 100 μM stock concentration.
  2. In a clean and template-free workspace, such as in a PCR hood, mix the oligonucleotides in the order outlined by the table below. Make sure to add the components from largest volume to the smallest volume.
    Oligo nameAdd for 100 μl of mix
    F32 μl
    B32 μl
    LF4 μl
    LB4 μl
    FIP16 μl
    BIP16 μl
    nuclease-free water56 μl
  3. Mix the finished primer mix by thoroughly pipetting up and down or by vortexing and briefly spinning down in a microfuge.
  4. Distribute the finished primer mix into Eppendorf tubes into conveniently sized aliquots, label the tubes and store at -20 ºC.

Ampure beads and bead dilution

 

This protocol explains in detail how to make a diluted Ampure bead solution from commercial RNA magnetic beads and pre-defined bead dilution buffer. The bead dilution is used for bead-LAMP.

  • Store the individual reagents according to the manufacturer's recommendation.
  • Tween-20 is very difficult to pipette, make sure you are aspirating the correct volume and pipette slowly.
  • Leave the bead dilution buffer, PEG and the magnetic beads out at room temperature for 30 minutes to let them warm up slowly. This makes the subsequent pipetting of this viscous solution more accurate. Store these reagents in the fridge at 2 to 8 °C when not using them.
  • It is recommended to prepare a fresh bead dilution for the expected number of tests at the beginning of the day.

Materials

  • NaCl (5 M), RNase-free, Catalog number: AM9759 (Thermofisher)
  • Polyethylene glycol solution 40 % (w/w) in H2O, average mol wt 8,000, Catalog number: P1458-50ML (MERCK/Sigma) 
  • UltraPure™ 1M Tris-HCI, pH 8.0, Catalog number: 15568025 (Thermofisher) 
  • Tween™ 20 Surfact-Amps™ Detergent Solution 10%, Catalog number: 85114
  • RNAClean XP, 40 mL, Catalog number: A63987 (Beckman Coulter) 

protocol

  1. Remove 40% Polyethylene glycol solution (PEG) from the fridge and let equilibrate to room temperature for about 30 minutes prior to using.
  2. Mix the following components in a 50 ml falcon tube and store the resulting bead dilution buffer at 2 to 8 °C.
    ReagentAmount to add (ml)Final concentration
    40% PEG2020 %
    5M NaCl19.42.5 M
    1M Tris-HCl pH 80.410 mM
    Tween™ 20 Surfact-Amps Detergent Solution0.20.05
    Final Volume40 
  3. Remove Ampure Dilution Buffer and Ampure RNAClean XP beads from the fridge and let adjust to room temperature for about 30 minutes prior to using it.
    [CRITICAL] It is important to let the bead dilution buffer and the beads adjust before use. Plan your time accordingly.
  4. Mix the following components in a 5 ml Eppendorf tube to obtain a 5x dilution of Ampure beads.
    ReagentVolume (ml)
    Ampure Dilution Buffer (see above)4
    Ampure RNAClean XP beads1
    Final Volume5

LAMP reagents

Commercial RT-LAMP assays are powered by enzymes that are produced by specialised companies. We found the LAMP kits from NEB to be very powerful in terms of performance and sensitivity, when used with our protocol. Therefore, we recommend purchasing the following reagents to anyone trying to get LAMP working in their settings as soon as possible.

  • Store the individual reagents according to the manufacturer's recommendation.

Materials

  • QuickExtract DNA solution 50ml (Lucigen QE09050), store at -20°C
  • WarmStart® Colorimetric LAMP 2X Master Mix with UDG (NEB M1804L), store at -20°C
  • SYTO™ 9 Green Fluorescent Nucleic Acid Stain, 5mM (2500X concentration), (Thermofisher S34854), store at -20°C under light protected conditions (only needed if performing fluorescence detection)
  • Ethanol, absolute (Sigma-Aldrich 51976)
  • Nuclease free water (not DEPC-treated) 100ml, (Thermofisher AM9938)
  • Guanidine hydrochloride solution, 8M (Sigma, G7294-100ML) (only needed if performing double-amplicon reactions with As1 and E1)

Protocol

SAMPLE INACTIVATION AND LYSIS (BSL2 WORKSPACE)

  1. Thaw an aliquot of QuickExtract DNA solution on ice and vortex before use (calculate for 50µl QuickExtract consumption per sample).
  2. On ice, mix 50µl of original sample material (nasopharyngal swab, gargle or saliva) with 50µl of QuickExtract solution in PCR strips or in a 96-well plate; seal the plate (or close the PCR strips with the lids).
  3. Heat-inactivate QuickExtract:Sample mix at 95°C for 5 minutes, then cool on ice or store at -20°C
    [PAUSE] Samples can be stored at -20°C at this point for up to four weeks, potentially longer. Inactivated samples can now be handled in BSL-1 settings.

bead-LAMP mastermix preparation (BSL-1 workspace)

Calculate your reagent consumption according to this table.

ReagentPer 20 ul reaction (μl)Final concentration
Colorimetric LAMP Kit with UTP/UDG (2x)101X
As1 Primer mix (10X)21X
E1 Primer mix (10X)21X
GuHCL (8M)0.140 mM
NEB LAMP dye 50X (optional)0.41X
Nuclease free waterto a total of 20 
  1. Prepare the beadLAMP reaction mix by mixing the reagents in the given order (top to bottom) and quickly vortex and spin down in a microfuge.
    [CRITICAL] If multiple reactions are performed, prepare a Mastermix for all reactions including a 10% excess. For example, when intending to run 10 reactions, prepare a Mastermix for 11 total reactions. This minimises pipetting errors and ensures enough reagent mixture to be distributed over individual PCR tubes or PCR wells.
    [OPTIONAL] If performing only colorimetric based detection, the fluorescent dye can be replaced with the same volume of nuclease-free water. Syto-9 can be added to record real-time fluorescent kinetic profiles and end-point fluorescence. This is especially useful when setting up the technique and optimising reaction conditions such as primers and sample types. It’s also useful for troubleshooting.

bead purification (BSL-1 workspace)

  1. To 100μl of inactivated QuickExtract Lysate in PCR tubes, add 60µl of diluted AmpureXP RNA beads (0.6x of lysate volume), mix and incubate for 5 minutes at room temperature.
    [CRITICAL] If real-time fluorescent signal is to be measured, transfer lysate to a PCR plate or PCR tubes suitable for real-time measurement. All downstream enrichment and detection steps are performed on this plate/tube.
    [CRITICAL]     For volumes smaller than 100µl, it is important to bring the volume up to 100µl with HBSS before addition of 60µl diluted beads. We have successfully used initial lysate volumes of 40-100µl.
  2. After 5 minutes, place mixtures containing samples and beads onto a magnetic rack for 5 minutes to allow for complete separation of beads from the solution.
    [CRITICAL]     It is important to wait for the complete separation to avoid losing beads. This is usually complete after 5 minutes and should be visible by accumulation of beads at the magnet-tube interphase.
  3. Without disturbing the beads, carefully remove the solution while keeping the tubes on the magnetic rack. 
    [CRITICAL] It’s important not to disturb the beads as the nucleic acid material is bound to them and would be lost. 
  4. While keeping the tubes on the magnetic stand, add 200µl of 85% EtOH solution to the beads and wait for 30 seconds, then remove the wash solution. 
    [CRITICAL] It’s important not to disturb the beads and to remove any residual ethanol since this can lead to a color-change of the Phenol dye from pink to yellow (without the reaction taking place).
  5. Remove tubes from the magnetic rack and allow the beads to air-dry for 3-5 minutes.
    [CRITICAL] Do not exceed 5 minutes to prevent full drying of the beads. Proceed to adding the master mix as soon as this time elapses and make sure there is no leftover ethanol in the reaction wells.

bead-lamp reaction (BSL-1 workspace)

  1. To each well/tube containing beads, add 20µl of LAMP reaction mixture and mix by pipetting to bring the beads into the solution. Seal PCR strips by capping them, and seal 96-well plates by applying a plastic transparent plate seal.
    [OPTIONAL] Alternatively, instead of mixing the beads with the reaction mix by pipetting, swiftly pipette the reaction mix onto the wells of the strip/plate, quickly but firmly cap/seal the strip/plate and carefully vortex to bring the beads into the reaction mix solution. This is especially useful when performing a lot of reactions, where individual mixing by pipetting would lead to long time delays and overdrying of the beads.
    [CRITICAL] Ensure that the beads went into solution. The mix should appear brownish with no transparent phase.
    [CRITICAL] If real-time fluorescence is recorded, transfer reaction to a suitable detection vessel (qPCR plate).
    [CRITICAL] If performing colorimetric detection, take an image of the PCR strips or 96-well plate with the mastermix and samples.
  2. Transfer the reaction to a suitable stable heat-source such as a thermocycler or heat-block and run reactions at 63°C for 25 minutes.
    [OPTIONAL] For real-time fluorescence data acquisition of bead-LAMP in a qPCR thermocycler, we typically perform 25 cycles at 63°C with 1-minute cycle length and reading at the end of each cycle. SYTO-9 or NEB fluorescent dye require data acquisitions using a standard FAM or SYBR filter (494nm/518nm absorption/emission).
  3. After 30 minutes run-time, remove reactions and allow to cool briefly at room temperature. Then proceed to inspect reactions visually. Negative reactions are pink while positive reactions are yellow.
    [CRITICAL] If performing colorimetric detection, take a second image of the PCR strips or 96-well plate under the same conditions as you took the first one after the reaction.

  4. [CRITICAL] Discard reactions. DO NOT open and DO NOT run on a gel.

See our other protocols

Open access RT-LAMP
Open access bead-LAMP
Commercial RT-LAMP
Commercial beadLAMP
Home
Get started
About LAMP
TEAM
NEWS
IMPRINT  |  info@rtlamp.org

© 2020 All rights reserved