bead-LAMP

protocol with open access reagents

Back To Homepage

Open access means freedom of information. With this protocol, anyone in the world can make their own RT-LAMP assays on a massive scale, producing most of the reagents themselves. Buffers for our open access assays are non-proprietary and their composition and preparation are listed here. Enzymes that power these reactions can be expressed and purified in any molecular biology lab in the world. A plasmid and four days of work is all it takes to produce enough enzymes for hundreds of thousands of RT-LAMP tests for SARS-CoV-2. The open access approach enables large scale, decentralised and supply chain independent testing strategies. Universities, biohacker collectives, governmental research institutions and many more are encouraged to take matters into their own hands and establish their own, robust production pipelines all over the world.

This protocol tells you how to express and purify enzymes, make magnetic beads, prepare required buffers, and assemble open-access bead-LAMP reactions for fast, sensitive, and accurate SARS-CoV-2 diagnostics.

Here's how it works...

Get plasmids

Order plasmids for enzyme production. Our plasmids are available from the nonprofit organisation Addgene.

Express and purify

Follow the published protocols to express enzymes for lots of reactions.

Benchmark and QC

Test your enzyme batches for activity and RT-LAMP reactions for sensitivity.

Start testing

Help secure easy, fast and cheap testing for your community.

Enzyme expression and purification

RT-LAMP reactions are catalysed by two enzymes, a reverse transcriptase that converts RNA to DNA, and a polymerase, that amplifies DNA in the presence of complementary primers. There are many enzymes that can do this, but non-patented wild-type enzymes best suited for this task are HIV-1 reverse transcriptase (HIV-RT) from the human immunodeficiency virus, and Bst polymerase Large Fragment, from the bacterium Bacillus stearothermophilus. Below, you can find the protocol to express these enzymes in E. coli and how to purify them. 

Download enzyme expression and purification protocol

Buffers and solutions

"DANUBE" INACTIVATION SOLUTION

Danube is an inactivation solution based on the HUDSON (Heating Unextracted Diagnostic Samples to Obliterate Nucleases) protocol. Danube can be prepared as a 10X solution, enabling a larger sample input. Adding 1 volume of Danube inactivation solution to 9 volumes of sample and heating the mixture to 95 ºC for 5 minutes results in non-infectious samples. This protocol reliably lyses viral particles, inactivates RNases that would inhibit the sample analysis and stabilises the overall mixture, and is compatible with a variety of downstream direct nucleic acid detection methods.

  • Danube inactivation buffer is named after the river flowing through Vienna!
  • If you don't have the stock solutions listed below on hand, you can prepare them yourself as long as you have analytical scales and other lab equipment. If you aren't sure how this is done, google "how to make 0.5 M EDTA solution" for example.
  • Use the prepared inactivation solution immediately.

Materials

  • Tris(2-carboxyethyl)phosphine hydrochloride solution, 0.5 M concentration, pH adjusted to 7.0 with ammonium hydroxide
  • Ethylenediaminetetraacetic (EDTA) solution, 0.5 M, pH 8.0
  • Betaine, 5 M solution
  • Proteinase K, 20 mg/ml, aqueous solution

Procedure

  1. Calculate the volume of “Danube” inactivation solution you need based on the amount of samples you plan to inactivate.
    For performing RT-LAMP, we recommend inactivating at least 10 microlitres of sample, which requires 1 microlitre of Danube per sample. For performing bead-LAMP, we recommend inactivating at least 100 microlitres of sample, which requires 10 microlitres of Danube.
  2. Calculate the volume of needed reagents for the number of samples you want to inactivate based on the following table
    ReagentStock concentration10x concentrationVolume to add for 1 ml
    TCEP0.5 M25 mM50 μl
    EDTA0.5 M10 mM20 μl
    Betaine5 M4.15 M830 μl
    Proteinase K20 mg/ml2 mg/ml100 μl
    Final Volume  1 ml
  3. Pipette the reagents together and mix by pipetting up and down or by vortexing and centrifuging.
  4. Use for inactivation of samples immediately.

Isothermal amplification buffer 10X

Isothermal amplification buffer is a well-known reagent in LAMP reactions. It provides optimal reaction conditions for a variety of polymerases derived from BstLF and the wild-type BstLF enzyme as well. A finished, ready to use 10X buffer can be purchased from New England Biolabs, but its composition is publicly known and the buffer itself is very easy to assemble. 

  • You can order Isothermal Amplification Buffer from NEB or make it yourself from stock solutions in a laboratory.
  • If you don't have these stock solutions on hand, you can prepare them yourself as long as you have analytical scales and other lab equipment. If you aren't sure how this is done, google "how to make 3 M potassium chloride" for example.
  • Store the prepared and sterile filtered buffer at -20 ºC.

Materials

  • Tris hydrochloride, pH 8.8, 1.5 M solution
  • Potassium chloride, 3 M solution
  • Ammonium sulfate, 1 M solution
  • Magnesium sulfate, 1 M solution
  • Tween® 20
  • Nuclease-free water

Procedure

  1. Prepare the materials either as pre-made stock solutions, or by making your own stock solutions.
  2. Calculate the volume of needed reagents for the number of samples you want to inactivate based on the following table
  3. ReagentStock concentration10x concentrationVolume to add for 1 ml
    Tris hydrochloride1.5 M200 mM133 μl
    Potassium chloride3 M500 mM167 μl
    Ammonium sulfate1 M100 mM100 μl
    Magnesium sulfate1 M20 mM20 μl
    Tween® 20100 %1 %10 μl
    Nuclease-free water  570 μl
    Final Volume   
        
  4. Pipette the reagents together and mix by pipetting up and down thoroughly or by vortexing and centrifuging.
  5. Filter through a sterile 0.22 μm syringe filter and store at -20 ºC.

LAMP primer mix 10X

LAMP requires six primers for optimal functioning. That is six short DNA oligonucleotides to synthesise or order, the names are F3, B3, LF, LB, FIP and BIP. For the ease of use, one can mix those in a pre-determined ratio to make a 10X primer mix to use with LAMP. You can make this mix with As1 primers against SARS-CoV-2 genome or against human ACTB transcript. Aliquot and label the finished primer mix with the name, date and name of the person who prepared it. We encourage to test every primer mix you receive for activity against the target template, especially when ordering from vendors you don’t have prior experience with. 

  • Store primer mixes at -20ºC.
  • Order oligonucleotides from reputable companies specialising in DNA oligonucleotide synthesis.
  • When ordering oligos, choose "standard desalting" as the purity. We recommend ordering primers resuspended in 100μM concentration. You can order yours lyophilised and then resuspend them in nuclease-free water according to the supplier's instructions.
  • This procedure is applicable for every LAMP primer set we recommend here.

Materials

SARS-COV-2 PRIMER SEQUENCES – As1 primers: 

As1_F3 CGGTGGACAAATTGTCAC 
As1_B3 CTTCTCTGGATTTAACACACTT 
As1_LF TTACAAGCTTAAAGAATGTCTGAACACT 
As1_LB TTGAATTTAGGTGAAACATTTGTCACG 
As1_FIP TCAGCACACAAAGCCAAAAATTTATCTGTGCAAAGGAAATTAAGGAG 
As1_BIP TATTGGTGGAGCTAAACTTAAAGCCCTGTACAATCCCTTTGAGTG

POSITIVE CONTROL PRIMER SEQUENCES – ACTB primers: 

ACTB-F3 AGTACCCCATCGAGCACG
ACTB-B3 AGCCTGGATAGCAACGTACA
ACTB-FIP GAGCCACACGCAGCTCATTGTATCACCAACTGGGACGACA
ACTB-BIP CTGAACCCCAAGGCCAACCGGCTGGGGTGTTGAAGGTC
ACTB-LoopF TGTGGTGCCAGATTTTCTCCA
ACTB-LoopB CGAGAAGATGACCCAGATCATGT

procedure

  1. Prepare your ordered oligonucleotides. If they are not resuspended, resuspend them in nuclease-free water for 100 μM stock concentration.
  2. In a clean and template-free workspace, such as in a PCR hood, mix the oligonucleotides in the order outlined by the table below. Make sure to add the components from largest volume to the smallest volume.
    Oligo nameAdd for 100 μl of mix
    F32 μl
    B32 μl
    LF4 μl
    LB4 μl
    FIP16 μl
    BIP16 μl
    nuclease-free water56 μl
  3. Mix the finished primer mix by thoroughly pipetting up and down or by vortexing and briefly spinning down in a microfuge.
  4. Distribute he finished primer mix into Eppendorf tubes into conveniently sized aliquots, label the tubes and store at -20 ºC.

Magnetic beads and bead dilution

 

For bead-LAMP, you can choose to buy commercial RNAClean XP beads from Beckman Coulter, or making your own beads as we describe in the following protocol. Going this route enables you to prepare your own beads at a fraction of the cost of the commercial beads, but it is slightly more time-consuming and requires to test if the bead purification provides you with the expected increase in sensitivity.

  • Store the individual reagents according to the manufacturer's recommendation.
  • Tween-20® is very difficult to pipette, make sure you are aspirating the correct volume and pipette slowly.

Materials

  • NaCl (5 M), RNase-free
  • Polyethylene glycol solution 50 % (w/w) in H2O, average mol wt 8,000 
  • Tris-HCI (1M), pH 8.0
  • EDTA (0.5M), pH 8.0
  • Tween™ 20 Surfact-Amps™ Detergent Solution 10%
  • Sera-Mag Magnetic SpeedBeads, #65152105050250, GE Healthcare, carboxylated, 1μm, 3EDAC/PA5
  • nuclease-free water

Preparation of DNA elution buffer

  1. Mix the following components in a 50 ml Falcon tube.
    Reagent Amount to add (ml)
    nuclease-free water 49.15
    1M Tris-HCl pH 8 0.5
    0.5M EDTA, pH 8.0 0.1
    Tween™20, 10% 0.25
  2. Store at 4 °C.

Preparation of incomplete binding buffer

  1. Mix the following components in a 50 ml Falcon tube.
    ReagentAmount to add (ml)
    5M NaCl12.5
    nuclease-free water2.075
    1M Tris-HCl pH 80.25
    0.5M EDTA, pH 8.00.05
  2. Mix well and use immediately in the following part of the protocol.

protocol

  1. Mix the Sera-Mag beads very well to resuspend.
  2. Transfer 0.5 ml to a 1.5 ml Eppendorf tube, work swiftly as the beads settle very quickly.
  3. Place the tube on a magnet and wait until the supernatant is clear, about 30 seconds.
  4. Remove and discard the supernatant.
  5. Add 0.5 ml of DNA elution buffer prepared before to the beads on the magnet.
  6. Remove tube from magnet and resuspend beads well by vortexing for at least 15 seconds, spin down briefly in a microcentrifuge.
  7. Put the tube back on the magnet and wait until the supernatant is clear.
  8. Remove and discard the supernatant.
  9. Repeat steps 5-8 for a total of 3 washes, keep beads in the supernatant after the last wash.
  10. Remove the supernatant from the beads. 
  11. Add 0.5 ml of incomplete binding buffer prepared before to the beads, keeping the rest of the incomplete binding buffer in the Falcon tube for later use.
  12. Resuspend beads by vortexing 15s. Briefly spin down in a microcentrifuge but do not pellet beads.
  13. Transfer the bead slurry to the Falcon tube containing the rest of the incomplete binding buffer.
  14. Repeat step 13-15 as long as residual beads are left in the Eppendorf tube.
  15. Vortex the bead and incomplete binding buffer slurry to mix.
  16. With a 10 ml Serological Pipette add 10 ml of PEG 8000 (50%). Dispense slowly and wait until all PEG is flowing towards the bottom of the pipette (ca. 10 min) to add the accurate amount of PEG. This is a critically important step.
  17. Add 0.125 ml Tween 20 (10%)
  18. Mix well by inverting gently
  19. Pour the finished bead slurry into a fresh 50 ml Bottle
  20. Label the tube properly and store at 4 °C. 
  21.  

bead-LAMP protocol

When you have the enzymes, primer mix, magnetic beads and the sample inactivation reagent, it’s time to assemble the reactions themselves. Make sure to test your reactions on a known positive sample dilution first to assess the specificity and sensitivity of your assays. Expressing and purifying your own enzymes is not trivial, but the payoff is tremendous. If you are expressing your enzymes and having issues with the resulting reactions, please contact us for help in troubleshooting. Please consider the following before you start: 

  • SARS-CoV-2 is a highly contagious virus and requires personal protection with appropriate safety standards. Please follow Biosafety level guidelines outlined by the CDC or your local authorities.
  • Separate working areas for sample preparation, reaction set-up and analysis are highly recommended. Clean work surfaces and pipettes with 5-10% bleach solution.
  • Do not open RT-LAMP reactions in order to prevent carry-over cross contamination leading to false positives. The addition of dUTP and Antarctic Thermolabile UDG enzyme to the reaction greatly reduces the contamination risk, therefore we strongly recommend adding them to your RT-LAMP reactions.
  • 96-well plates must be properly sealed. This is absolutely crucial to prevent cross-well contamination. Proper plate seals (e.g. tight sealing plastic covers or aluminium seals), a proper plate-roller (e.g. BioRad) or even better a PCR plate sealer (e.g. BioRad PX1 PCR plate sealer) can help prevent cross-well contamination.
  • Store reaction components at the appropriate temperatures outlined in the protocol or by the manufacturer. It is crucial to thoroughly mix all components prior to use to ensure the homogeneity of the reagents.
  • Colorimetric and fluorescent detection can be performed in the same reaction by simple addition of both dyes (the colorimetric HNB dye and SYTO-9 fluorescent dye that is listed in the protocol as optional).
  • When working with crude samples lysed in Danube inactivation buffer, keep samples on ice whenever possible. While we have observed complete inactivation of nucleases after 5 minutes at 95°C, we found considerable RNase activity in biological sample types such as saliva and gargle. Due to the FBS content in Universal Transport Media (UTM), nasopharyngeal swabs in this medium may also contain RNases.
  • RT-LAMP uses six primers, two inner loop primers (FIP, BIP), loop primers (LF, LB) and outer bumping primers (F3, B3). A reaction contains all six primers if a single amplicon is tested.
  • A positive control amplicon detecting the human ACTB gene can be used to confirm the presence of human nucleic acid sample material in the sample, and the absence of general reaction-inhibiting substances in the sample.
  • A crucial component of every experiment and testing procedure is the selection of proper controls. For verifying that your reaction mastermix works in the given conditions for the detection of SARS-CoV-2 genome, we recommend the use of inactivated qPCR positive patient sample, synthetic SARS-CoV-2 RNA or plasmid DNA containing the Orf1ab region. Positive controls should have a concentration exceeding 100 copies/µl. Verified qPCR negative sample is a proper choice for a negative control.
  • The enzymes you produce are likely different in activity from those that other labs produce. Make sure to test your enzymes for activity.
  • The concentration of your enzymes will differ from the one used in this protocol. Take this into account and make sure to add enough to match the final concentrations in the table below. ​
  • Dilute enzymes in the dilution buffer as described in the enzyme expression and purification protocol to preserve their activity and protect them from degradation.
  • Store enzymes at -80ºC in single use aliquots and work with enzymes on ice.

SAMPLE INACTIVATION AND LYSIS USING DANUBE INACTIVATION SOLUTION (BSL2 WORKSPACE)

  1. Prepare Danube 10X inactivation solution according to the protocol above.
  2. In a BSL-2 workspace with extra precautions taken against respiratory viruses, add 90 μl of sample to 10 μl of Danube inactivation solution. Mix by pipetting up and down several times. 
    [CRITICAL] Make sure to adhere to the safety precautions for handling potentially infectious SARS-CoV-2 samples outlined by applicable health authorities in your jurisdiction.
  3. Heat-inactivate the mixture of sample and inactivation solution at 95°C for 5 minutes.
  4. Cool the inactivated samples on ice or at room temperature for immediate use or store at -20°C.
    [PAUSE] Samples can be stored at -20°C at this point for up to four weeks, potentially longer. Inactivated samples can now be handled in BSL-1 settings.

BEAD-LAMP MASTERMIX PREPARATION (BSL-1 WORKSPACE)​

  1. Calculate your reagent consumption for assembling the RT-LAMP reaction master mix according to the table below. Multiply the last column by the number of samples you plan to test + 2 for a positive and negative control. Multiply this number by 1.1 to make sure you prepare an excess to compensate for pipetting error.
    ReagentStock concentrationFinal concentrationTo add per reaction
    Isothermal amplification buffer10X1X1 μl
    dNTP mix25 mM1.4 mM0.56 μl
    dUTP100 mM0.7 mM0.07 μl
    Magnesium sulfate100 mM6 mM0.6 μl
    As1 primer mix10X1X1 μl
    HNB dye, trisodium salt20 mM0.12 mM0.06 μl
    Syto9 fluorescent dye (optional)100 μM2 μM0.2 μl
    Betaine5 M0.4 M0.8 μl
    HIV-RT enzyme0.55 mg/ml0.00275 mg/ml0.05 μl
    BstLF enzyme0.6 mg/ml0.02 mg/ml0. 33 μl
    Thermolabile UDG enzyme1 U/μl0.02 U/μl0.2
    Nuclease-free water  to a total of 8 μl
    Final Volume  8 μl
        
  2. Prepare the bead-LAMP reaction master mix by mixing the reagents in an Eppendorf tube on ice. Add the enzymes last.
    [CRITICAL] Make sure to add the enzyme components last! They will otherwise denature and you will experience decreased assay performance or no activity at all.
    [CRITICAL] Assemble the RT-LAMP reaction master mix on ice.
  3. Mix the reagents by thoroughly pipetting up and down or by vortexing and spinning down in a microfuge. Keep the bead-LAMP reaction master mix on ice until use.

Bead purification (BSL-1 workspace)

  1. To 100 μl of inactivated sample in PCR tubes, add 60µl of diluted magnetic beads (0.6x of sample volume), thoroughly mix by pipetting up and down 10 times and incubate for 5 minutes at room temperature.
    [CRITICAL] If real-time fluorescent signal is to be measured, transfer lysate to a PCR plate or PCR tubes suitable for real-time measurement. All downstream enrichment and detection steps are performed on this plate/tube.
    [CRITICAL]     For volumes smaller than 100µl, it is important to bring the volume up to 100µl with HBSS before addition of 60µl diluted beads. We have successfully used initial lysate volumes of 40-100µl.
  2. After 5 minutes, place mixtures containing samples and beads onto a magnetic rack for 5 minutes to allow for complete separation of beads from the solution.
    [CRITICAL]     It is important to wait for the complete separation to avoid losing beads. This is usually complete after 5 minutes and should be visible by accumulation of beads at the magnet-tube interphase.
  3. Without disturbing the beads, carefully remove the solution while keeping the tubes on the magnetic rack. 
    [CRITICAL] It’s important not to disturb the beads as the nucleic acid material is bound to them and would be lost. 
  4. While keeping the tubes on the magnetic stand, add 200µl of 85% EtOH solution to the beads and wait for 30 seconds, then remove the wash solution. 
    [CRITICAL] It’s important not to disturb the beads and to remove any residual ethanol since this can lead to a color-change of the phenol dye from pink to yellow (without the reaction taking place).
  5. Remove tubes from the magnetic rack and allow the beads to air-dry for 3-5 minutes.
    [CRITICAL] Do not exceed 5 minutes to prevent full drying of the beads. Proceed to adding the master mix as soon as this time elapses and make sure there is no leftover ethanol in the reaction wells.

bead-LAMP reaction (BSL-1 workspace)

  1. To each well/tube containing beads, add 20µl of LAMP reaction mixture and mix by pipetting to bring the beads into solution. Seal PCR strips by capping them, and seal 96-well plates by applying a plastic transparent plate seal.
    [OPTIONAL] Alternatively, instead of mixing the beads with the reaction mix by pipetting, swiftly pipette the reaction mix onto the wells of the strip/plate, quickly but firmly cap/seal the strip/plate and carefully vortex to bring the beads into the reaction mix solution. This is especially useful when performing a lot of reactions, where individual mixing by pipetting would lead to long time delays and overdrying of the beads.
    [CRITICAL] Ensure that the beads went into solution. The mix should appear brownish with no transparent phase.
    [CRITICAL] If real-time fluorescence is recorded, transfer reaction to a suitable detection vessel (qPCR plate).
    [CRITICAL] If performing colorimetric detection, take an image of the PCR strips or 96-well plate with the mastermix and samples.
  2. Transfer the reaction to a suitable stable heat-source such as a thermocycler or heat-block and run reactions at 63°C for 25 minutes.
    [OPTIONAL] For real-time fluorescence data acquisition of bead-LAMP in a qPCR thermocycler, we typically perform 25 cycles at 63°C with 1-minute cycle length and reading at the end of each cycle. SYTO-9 or NEB fluorescent Dye require data acquisitions using a standard FAM or SYBR filter (494nm/518nm absorption/emission).
  3. After 25 minutes run-time, remove reactions and allow to cool briefly at room temperature. Then proceed to inspect reactions visually. Negative reactions are purple while positive reactions are sky blue.
    [CRITICAL] If performing colorimetric detection, take a second image of the PCR strips or 96-well plate under the same conditions as you took the first one after the reaction.
    [CRITICAL] Discard reactions. DO NOT open and DO NOT run on a gel.

See our other protocols

Open access RT-LAMP
Open access bead-LAMP
Commercial RT-LAMP
Commercial beadLAMP
Home
Get started
About LAMP
TEAM
NEWS
IMPRINT  |  info@rtlamp.org

© 2020 All rights reserved